View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11968_high_13 (Length: 241)
Name: NF11968_high_13
Description: NF11968
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11968_high_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 55161683 - 55161458
Alignment:
| Q |
1 |
acaagtgaagaaggcatgttgatgttggtgttgttaacagcattacccttgtccttgatattgaaaactcctcctccgtaaagtggcttctctggatgct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55161683 |
acaagtgaagaaggcatgttgatgttggtgttgttaacagcattacccttgtccttgatattgaaaactcctcctccgtaaagtggcttctctggatgct |
55161584 |
T |
 |
| Q |
101 |
ctttgcactgtc-aaagtctcaactatgcatgtcagttctatatatgacatttgtctgtcatatagaagaatactacaa-ttataagttacaaaacaaca |
198 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
55161583 |
ctttgcactgtcaaaagtctcaactatgcatgtcagttctatatatgacatttgtctgtcatatagaagaatactacaagttataagttacaaaacaaca |
55161484 |
T |
 |
| Q |
199 |
acaacatgaattgaattgaattgaat |
224 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
55161483 |
acaacatgaattgaattgaattgaat |
55161458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University