View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11968_high_9 (Length: 254)
Name: NF11968_high_9
Description: NF11968
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11968_high_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 1 - 166
Target Start/End: Original strand, 37001948 - 37002113
Alignment:
| Q |
1 |
gatttcttctgatcatgaaatttcattttgtcaattttgtttcttaattatcaagtttctaactcagaggtgtcataatttgataacaataaactattct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
37001948 |
gatttcttctgatcatgaaatttcattttgtcaattttgtttcttaattatgaactttctaactcagcggtgtcataatttgataacaataaactattct |
37002047 |
T |
 |
| Q |
101 |
actacatgaatttataagacgatgttgctctaatccatcaatttatcgaaactgcaaaaatttccc |
166 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37002048 |
actacatgaatgtataagacgatgttgctctaatccatcaatttatcgaaactgcaaaaatttccc |
37002113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University