View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1196_high_3 (Length: 424)
Name: NF1196_high_3
Description: NF1196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1196_high_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 318; Significance: 1e-179; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 318; E-Value: 1e-179
Query Start/End: Original strand, 30 - 399
Target Start/End: Original strand, 45725249 - 45725622
Alignment:
| Q |
30 |
atatgaccttgcgtgaccatggccaagtggatggaagccaaatcaagttcatgattttgactgctcttatctcctttattgcaaagagagattctctttc |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45725249 |
atatgaccttgcgtgaccatggccaagtggatggaagccaaatcaagttcatgattttgactgctcttatctcctttattgcaaagagagattctctttc |
45725348 |
T |
 |
| Q |
130 |
tannnnnnnncttttgttcagtggattcatgtccatttcatttacccaagtatttaaattttacgtaacaataaattagcaacactattatagtatcatc |
229 |
Q |
| |
|
|| |||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45725349 |
tattttttt-cttttgttcagtggattcttatccatttcatttacccaagtatttaaattttacgtaacaataaattagcaacactattatagtatcatc |
45725447 |
T |
 |
| Q |
230 |
acttttttgctactacatttgcaattgttttatgcttatgggatctatttaacttgaagtgcaataaaaatgtactatagttagatgggtacagtgtaat |
329 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45725448 |
acttttttgctactacatttgcaattgttttatgcttatgggatctatttaacttgaagtgcaataaaaatgtactatagttagatgggtacagtgtaat |
45725547 |
T |
 |
| Q |
330 |
actcaagtgatgc-----caatgatcgaagtacgagttgtaaataagatcaatttgtgcagatagatatgtgttg |
399 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45725548 |
actcaagtgatgccaatgcaatgatcgaagtacgagttgtaaataagatcaatttgtgcagatagatatgtgttg |
45725622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 61 - 131
Target Start/End: Complemental strand, 27585645 - 27585573
Alignment:
| Q |
61 |
tggaagccaaatcaa-gttcatgattttgactgct-cttatctcctttattgcaaagagagattctctttcta |
131 |
Q |
| |
|
||||| ||||||||| |||| ||||||||||| | | ||||||||||||||||||||||||||||||||||| |
|
|
| T |
27585645 |
tggaaaccaaatcaaagttcctgattttgacttcgacctatctcctttattgcaaagagagattctctttcta |
27585573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University