View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1196_low_12 (Length: 312)
Name: NF1196_low_12
Description: NF1196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1196_low_12 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 5 - 292
Target Start/End: Original strand, 43118730 - 43119017
Alignment:
| Q |
5 |
agtttgtagggggaccatactatgatgtacattgatcaatatatcaacctataactatagaactactcataacatatttattcatgcttcgattcaagag |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
43118730 |
agtttgtagggggaccatactatgatgtacattgatcaatatatcaacctataactatagaactactcataacatatttattcatgctttgattcaagag |
43118829 |
T |
|
| Q |
105 |
cttacacattcaatatcttctttacttgcaatatgaaaatggggtagttcaaaggtgaaattcgaagttaggaataagctggttgtgtagggttattgac |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
43118830 |
cttacacattcaatatcttctttacttgcaatatgaaaatggggtagttcaaaggtgaaattcgaagttaggaataagctggttgtgcagggttattgac |
43118929 |
T |
|
| Q |
205 |
aaaccttgcttatatcaagcataaaaagatatgtttaacccatacatgacgtgcttataacttattataattcacatatgtataaata |
292 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43118930 |
aaaccttgcttatatcaaggataaaaagatatgtttaaccctttcatgacgtgcttataacttattataattcacatatgtataaata |
43119017 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University