View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1196_low_15 (Length: 256)
Name: NF1196_low_15
Description: NF1196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1196_low_15 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 2 - 256
Target Start/End: Original strand, 35999983 - 36000230
Alignment:
| Q |
2 |
gcatgtccaaaaatattttgttctttgaaaattgaaattagttatatgatattgcatgtacagaatcaactttcttacaaatgggaatcaactttgttat |
101 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35999983 |
gcatatccaaaaatattttgttctttgaaaattgaaattagttatatgatattgcatgtacagaatcaactttcttacaaatgggaatcaactttgttat |
36000082 |
T |
 |
| Q |
102 |
gaaagtatatttaagaaaatgcaagaaaactaataatgacatgtataggacatatcatatgacttagtaagtaaggtcggtttaaagaggaggtctatca |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
36000083 |
gaaagtatatttaagaaaatgcaagaaaac---taatgacatgtataggacatatcatatgactt----agtaaggtcggtttaaagaggaggtctatca |
36000175 |
T |
 |
| Q |
202 |
caacaatggggaccatatataacagaaacagtagaaacaagaaagttccctagga |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36000176 |
aaacaatggggaccatatataacagaaacagtagaaacaagaaagttccctagga |
36000230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University