View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1196_low_16 (Length: 253)
Name: NF1196_low_16
Description: NF1196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1196_low_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 151; Significance: 5e-80; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 75 - 229
Target Start/End: Complemental strand, 2151267 - 2151113
Alignment:
| Q |
75 |
agatgaaccttataactttgtcactgtcaaggattttgctcgagccttcgaattatttcacgtaggcaaacaacttggagaagagctggccgatccattt |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2151267 |
agatgaaccttataactttgtcactgtcaaggattttgctcgagccttcgaattatttcacataggcaaacaacttggagaagagctggccgatccattt |
2151168 |
T |
 |
| Q |
175 |
gacaagtctaaatttcattcaaatgtcttgatcacaaagaaatatgggattaaca |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2151167 |
gacaagtctaaatttcattcaaatgtcttgatcacaaagaaatatgggattaaca |
2151113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 75 - 218
Target Start/End: Complemental strand, 2163545 - 2163402
Alignment:
| Q |
75 |
agatgaaccttataactttgtcactgtcaaggattttgctcgagccttcgaattatttcacgtaggcaaacaacttggagaagagctggccgatccattt |
174 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||||||| ||| || | |||||||| |||| || |||||||||| ||||| ||| |||| ||| |
|
|
| T |
2163545 |
agatgaaccttatagttttgttactgtcaaggattttgccgaagcatttcagatatttcacataggtcaaaaacttggagatgagctagccaatcctttt |
2163446 |
T |
 |
| Q |
175 |
gacaagtctaaatttcattcaaatgtcttgatcacaaagaaata |
218 |
Q |
| |
|
|||||||| |||| ||| ||| |||||||| |||||||||||| |
|
|
| T |
2163445 |
gacaagtcgaaatgccatgcaagtgtcttgaccacaaagaaata |
2163402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 146 - 221
Target Start/End: Original strand, 4302471 - 4302546
Alignment:
| Q |
146 |
aacttggagaagagctggccgatccatttgacaagtctaaatttcattcaaatgtcttgatcacaaagaaatatgg |
221 |
Q |
| |
|
|||||||||| ||||| ||| |||| ||||| || ||||||| ||| |||||||||||| ||||||||||||||| |
|
|
| T |
4302471 |
aacttggagatgagctagccaatccttttgaaaaatctaaatgccatgcaaatgtcttgaccacaaagaaatatgg |
4302546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University