View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1196_low_17 (Length: 235)
Name: NF1196_low_17
Description: NF1196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1196_low_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 150; Significance: 2e-79; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 1 - 150
Target Start/End: Complemental strand, 23989522 - 23989373
Alignment:
| Q |
1 |
ccgggaaacaactgtaaacatgttcaaagatctcattgtgcagtccgttccatagatactcattgtaatcatcattccacccgtgatgatcctcatacaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23989522 |
ccgggaaacaactgtaaacatgttcaaagatctcattgtgcagtccgttccatagatactcattgtaatcatcattccacccgtgatgatcctcatacaa |
23989423 |
T |
|
| Q |
101 |
attctcattgcactgaccctcgatcgaaactacattcaaccgatcctcct |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23989422 |
attctcattgcactgaccctcgatcgaaactacattcaaccgatcctcct |
23989373 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 6 - 130
Target Start/End: Complemental strand, 23982835 - 23982708
Alignment:
| Q |
6 |
aaacaactgtaaacatgttcaaagatctcattgtgcagtccgttccatagatactcattgtaatcatcat---tccacccgtgatgatcctcatacaaat |
102 |
Q |
| |
|
||||||||||||| ||||||||| |||||| ||||| |||||||||||| || | ||||||||| ||||||| ||||| ||||||| ||||| |
|
|
| T |
23982835 |
aaacaactgtaaaattgttcaaaggtctcatcaggcagtgcgttccatagatccttaacaaaatcatcatcgttccacccatgatgttcctcatgcaaat |
23982736 |
T |
|
| Q |
103 |
tctcattgcactgaccctcgatcgaaac |
130 |
Q |
| |
|
||||||| ||||||||||| || ||||| |
|
|
| T |
23982735 |
tctcattccactgaccctcaattgaaac |
23982708 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 5 - 40
Target Start/End: Complemental strand, 23965529 - 23965494
Alignment:
| Q |
5 |
gaaacaactgtaaacatgttcaaagatctcattgtg |
40 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
23965529 |
gaaacaactgtaaacatgttcaaagatctcattgtg |
23965494 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University