View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1196_low_6 (Length: 372)
Name: NF1196_low_6
Description: NF1196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1196_low_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 106; Significance: 6e-53; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 106; E-Value: 6e-53
Query Start/End: Original strand, 28 - 199
Target Start/End: Complemental strand, 43613070 - 43612897
Alignment:
| Q |
28 |
cactttctaacaatgggga-gctcctatgaattgcaagaagagaaaagttgataaattttctgattaacttctcattgttaccaatcatagtctaagtag |
126 |
Q |
| |
|
||||||||| |||||||| ||||||||||| ||||||||||||||||||||| ||||||||||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
43613070 |
cactttctagcaatgggggtgctcctatgaactgcaagaagagaaaagttgatgaattttctgattaacatctcattgtttccaatcatagtctaagtag |
43612971 |
T |
|
| Q |
127 |
aggtattacaactgtacatgaacgttggacaacacaagccact-accacagtaactatggaaaataacattgaa |
199 |
Q |
| |
|
||||||| ||| ||||||||||||||||||||||||||||| | || |||||||||| | ||||| |||||||| |
|
|
| T |
43612970 |
aggtattgcaaatgtacatgaacgttggacaacacaagccattaacgacagtaactaagtaaaatgacattgaa |
43612897 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 38 - 116
Target Start/End: Complemental strand, 43644252 - 43644174
Alignment:
| Q |
38 |
caatggggagctcctatgaattgcaagaagagaaaagttgataaattttctgattaacttctcattgttaccaatcata |
116 |
Q |
| |
|
|||||||| ||| ||||||| |||||| |||||||| ||||||||||||||||||||||||||| ||| ||||| |||| |
|
|
| T |
43644252 |
caatggggtgcttctatgaaatgcaagtagagaaaaattgataaattttctgattaacttctcactgtaaccaaccata |
43644174 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University