View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1196_low_8 (Length: 342)
Name: NF1196_low_8
Description: NF1196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1196_low_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 147; Significance: 2e-77; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 91 - 269
Target Start/End: Original strand, 22101686 - 22101864
Alignment:
| Q |
91 |
ctgttgttactcgagggtgtactgttgaaatcatccctcgatctgggttctacgtgtgtttggagcttgtttcctctgagtcattccgtgggattggcta |
190 |
Q |
| |
|
||||||| ||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
22101686 |
ctgttgtgacttgagggtgtactgttgaaatcatccctcgatctgggttctacgcgtgtttggagcttgtttcctctgagtcattccgtgtgattggcta |
22101785 |
T |
 |
| Q |
191 |
cagggctacaaatggcatgtggaagcttattgtttcgttgctgcgcaatgagctgtaggtgtggggtttcatatctgtg |
269 |
Q |
| |
|
||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
22101786 |
tagggctataaatggcatgtggaggcttattgtttcgttgctgcgcaatgagctgtaggtgtggggtttcgtatctgtg |
22101864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University