View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11970_high_9 (Length: 230)
Name: NF11970_high_9
Description: NF11970
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11970_high_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 14 - 214
Target Start/End: Complemental strand, 46157163 - 46156963
Alignment:
| Q |
14 |
gagaagaaagcttgcagaagaagaggcgtgaaggacttcaacctcagcagatacctgcatcagttcaatctaatctactcgagaaaaaggtctagattct |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46157163 |
gagaagaaagcttgcagaagaagaggcgtgaaggacttcaacctcagcagatgcctgcatcagttcaatctaatctactcgagaaaaaggtctagattct |
46157064 |
T |
 |
| Q |
114 |
tttgatctcactactttacgtgttctttccgattttctttttcttttattaattaattacttccatacttgtttaattgtgaaattgatagtagtggtta |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46157063 |
tttgatctcactactttacgtgttctttccgattttctttttcttttattaattaattacttccatacttgtttaattgtgaaattgatagtagtggtta |
46156964 |
T |
 |
| Q |
214 |
g |
214 |
Q |
| |
|
| |
|
|
| T |
46156963 |
g |
46156963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University