View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11971_high_18 (Length: 306)
Name: NF11971_high_18
Description: NF11971
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11971_high_18 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 1 - 287
Target Start/End: Original strand, 49206293 - 49206579
Alignment:
| Q |
1 |
tgagcagcggcacggcaatagcggtgagagggatgatgtccaggagaggaaaaaagttgaagggatggatggtgtcaaaggacgtagtagaagcgaaaag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49206293 |
tgagcagcggcacggcaatagcggtgagagggatggtgtccaggagaggaaaaaagttgaagggatggatggtgtcaaaggacgtagtagaagcgaaaag |
49206392 |
T |
|
| Q |
101 |
catgatttgatttcaatttattttgttgttggtggtggatgtgggttaggttagaactatcatgattttaacaagtgattggagctaccaagctaccata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49206393 |
catgatttgatttcaatttattttgttgttggtggtggatgtgggttaggttagaactatcatgattttaacaagtgattggagctaccaagctaccata |
49206492 |
T |
|
| Q |
201 |
taaccaaaattttgaggccctgtaaattggtaaagaactccttatttcatgacttacgcataccgacaaaaagaataaccacgatgt |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
49206493 |
taaccaaaattttgaggccctgtaaattggtaaagaactcgttatttcatgacttacgcataccgacaacaaaaataaccacgatgt |
49206579 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University