View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11971_high_23 (Length: 253)
Name: NF11971_high_23
Description: NF11971
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11971_high_23 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 131; Significance: 5e-68; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 15 - 209
Target Start/End: Complemental strand, 36525860 - 36525666
Alignment:
| Q |
15 |
atgaatgaacatagtttaggtttgatttagtttaacacaaaactttaggtaaattttgagaatatgtttgtcaaaactttgtgctgaatataaactctcc |
114 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
36525860 |
atgaatgaaaatagtttaggtttgatttagtttaacacaa--ctttaggtaaattttgagaatatgtttgtctaaactttgtgctgaatataaactctcc |
36525763 |
T |
 |
| Q |
115 |
atgaatttgtc--nnnnnnnnctctccatgaaaaataaatagtaacataagaacagaaattgaataagctttcaatatgatactaacattagcctat |
209 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
36525762 |
atgaatttgtcaaaaaataaactctccatgaaaaataaatagtaacataagaacagaaattgaataacctttcaatatgatactaacgctagcctat |
36525666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 218 - 253
Target Start/End: Complemental strand, 36525263 - 36525228
Alignment:
| Q |
218 |
ttatcctttcattttcttcgtgcacaatctttcttc |
253 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |
|
|
| T |
36525263 |
ttatcctttcattttcttcgtgcataatctttcttc |
36525228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University