View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11971_low_22 (Length: 301)
Name: NF11971_low_22
Description: NF11971
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11971_low_22 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 19 - 296
Target Start/End: Original strand, 5460812 - 5461068
Alignment:
| Q |
19 |
aatagggaatcaccaagaattcgagcaatgcattaacaaagaagcatggctagtattaagatcaaaagattgaaactatctagacctgtgcttaaagctt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
5460812 |
aatagggaatcaccaagaattcgagcaatgcattaacaaagaagcatggctagtattaagatcaaaagattgaaactatctatacctgtgcttaaagctt |
5460911 |
T |
|
| Q |
119 |
atgctcaataattgtttatgaagatttagtccaaataagtaacagctaaataatgttcacccaaacccttctgcttgcttccaaaactcaccttgtgaac |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
5460912 |
atgctcaataattgtttatgaagatttagtccaaataagtaacagctaaataatgttcacccaaacccttctg---------------------ttgaac |
5460990 |
T |
|
| Q |
219 |
ttccttatacttttcttgatcgaccaacttgacacaactaatcattattctaatcattgatattaatttcttctctct |
296 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5460991 |
ttccttatacttttcttgattgaccaacttgacacaactaatcattattctaatcattgatattaatttcttctctct |
5461068 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University