View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11971_low_28 (Length: 246)
Name: NF11971_low_28
Description: NF11971
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11971_low_28 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 170; Significance: 2e-91; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 49 - 230
Target Start/End: Original strand, 4271694 - 4271875
Alignment:
| Q |
49 |
aagattgcgaggaagatttgaagggtctcacgaaaagtgaggttactgtgattgacacaagttgtcgagtgtggaaggttgataaatttgttttcagaaa |
148 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4271694 |
aagattgcgaggaagatttgaagggtttcacgaaaagtgaggttactgtgattgacacaagttgtcgagtgtggaaggttgataaatttgttttcagaaa |
4271793 |
T |
 |
| Q |
149 |
gaataattggaaaataagagagaggaaacaaaagaacaagtttgttgcgaagaagaagagtaaattgactcatgagcttgat |
230 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
4271794 |
gaatgattggaaaataagagagaggaaacaaaagaacaagtttgttgcgaagaagaagagtaaattgactcgtgagcttgat |
4271875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 57 - 229
Target Start/End: Original strand, 42346596 - 42346771
Alignment:
| Q |
57 |
gaggaagatttgaagggtctcacgaaaagtgaggttactgtgattgacacaagttgtcgagtgtggaaggttgataaatttgttttcagaaagaataa-- |
154 |
Q |
| |
|
||||||||||| |||||| ||||||||||||||||||||||||| ||||| ||||||| ||||||||| |||||||| ||||| ||||||| |||||| |
|
|
| T |
42346596 |
gaggaagatttcaagggtttcacgaaaagtgaggttactgtgatagacacgagttgtccagtgtggaaagttgataagtttgtgttcagaaggaataatg |
42346695 |
T |
 |
| Q |
155 |
-ttggaaaataagagagaggaaacaaaagaacaagtttgttgcgaagaagaagagtaaattgactcatgagcttga |
229 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
42346696 |
tttggaaaatcagagagaggaaacaaaagaacaagtttgtagcgaagaagaagagtaaatcgacccatgagcttga |
42346771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University