View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11971_low_34 (Length: 224)
Name: NF11971_low_34
Description: NF11971
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11971_low_34 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 146; Significance: 5e-77; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 46 - 210
Target Start/End: Complemental strand, 27836392 - 27836227
Alignment:
| Q |
46 |
catattttaattaaactgagacttta-ttgttctaataactaataattccaagtacagtttatggtaattgcttgtgcagattcaagggtatgcccctct |
144 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
27836392 |
catattttaattaaactgagactttaattgttctaataactaataaatccaagtacagtttatggtaattgcttgtgcagattcaagggtgtgcccctct |
27836293 |
T |
|
| Q |
145 |
aacatattaggattccaacctggtgaagtctttatgatacgtaacattgccaatcttgtacctatg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
27836292 |
aacatattaggattccaacctggtgaagtctttatgatacgtaacattgccaatcttgtgcctatg |
27836227 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 91 - 164
Target Start/End: Complemental strand, 1939655 - 1939582
Alignment:
| Q |
91 |
ttccaagtacagtttatggtaattgcttgtgcagattcaagggtatgcccctctaacatattaggattccaacc |
164 |
Q |
| |
|
||||||| |||||| ||||| ||||| ||||||||||| |||||||||||||| || || || ||||| ||||| |
|
|
| T |
1939655 |
ttccaagaacagttcatggttattgcctgtgcagattccagggtatgcccctccaatattttgggatttcaacc |
1939582 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University