View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11972_low_5 (Length: 398)
Name: NF11972_low_5
Description: NF11972
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11972_low_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 312; Significance: 1e-176; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 312; E-Value: 1e-176
Query Start/End: Original strand, 1 - 384
Target Start/End: Original strand, 56329952 - 56330348
Alignment:
| Q |
1 |
gaaaaagaaaagcgaaaatctagtgggagtgggagtgaaatata--attgaaattgaaattgaaattgaag-----agaagagaaagaggatggaaggaa |
93 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
56329952 |
gaaaaagaaaagcgaaaatctagtgggagtgggagtgaaatatataattgaaattgaaattgaaattgaagagaagagaagagaaagaggatggaaggaa |
56330051 |
T |
 |
| Q |
94 |
tggcacagcacccggtacctcgaactgttgaagaagtttttagcgattacaaaggcagacgcgccggtttgatcaaagctctaactaccggtcagtcact |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
56330052 |
tggcacagcacccggtacctcgaactgttgaagaagtttttagcgattacaaaggcagacgcgccggtttgatcaaagctctcactactggtcagtcact |
56330151 |
T |
 |
| Q |
194 |
tcatcattctcgcgactattattttt---catttttacttaatcattcttattcttcttctctttcagacgttgaaaagttttaccagctctgcgatccc |
290 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56330152 |
tcatcattctcgcgactattatttttaaacatttttacttaatcatccttattcttcttctctttcagacgttgaaaagttttaccagctctgcgatccc |
56330251 |
T |
 |
| Q |
291 |
ggttagt----tctctctctccttttcttcaccgtgtgtctgcgcgctttttataattctacaattcagtacccgttattttctgctatgctcttact |
384 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56330252 |
ggttagttctctctctctctccttttcttcaccgtgtgtctgcgcgc-tttcataattctacaattcagtacccgttattttctgctatgctcttact |
56330348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University