View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11972_low_7 (Length: 355)
Name: NF11972_low_7
Description: NF11972
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11972_low_7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 237; Significance: 1e-131; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 97 - 337
Target Start/End: Original strand, 32759234 - 32759474
Alignment:
| Q |
97 |
aattcaacactccaaccaaacaccttcacctcaagatgcgaattccgatcaataaccgactcagaaccctcatcacccattctccctccaaattccgcca |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32759234 |
aattcaacactccaaccaaacaccttcacctcaagatgcgaattccgatcaataaccgactcagaaccctcatcacccattctccctccaaattccgcca |
32759333 |
T |
|
| Q |
197 |
tgtttctacctgtagagctgttcttcttccctctttcggtggaccccaaaacctcgaaatccaccccaatgtcgaagtccctcctctcaaacccaacgaa |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32759334 |
tgtttctacctgtagagctgttcttcttccctcttttggtggaccccaaaacctcgaaatccaccccaatgtcgaagtccctcctctcaaacccaacgaa |
32759433 |
T |
|
| Q |
297 |
gtcctcgttcactctcgtgcagtttccatcaaccctctaga |
337 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32759434 |
gtcctcgttcactctcgtgcagtttccatcaaccctctaga |
32759474 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 31
Target Start/End: Original strand, 32759147 - 32759177
Alignment:
| Q |
1 |
ctttctgcgttccaaaacagagacacgttcc |
31 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
32759147 |
ctttctgcgttccaaaacagagacacgttcc |
32759177 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University