View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11973_high_2 (Length: 268)
Name: NF11973_high_2
Description: NF11973
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11973_high_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 191; Significance: 1e-104; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 250
Target Start/End: Original strand, 7415258 - 7415522
Alignment:
| Q |
1 |
acttcaagtttgtagtctagagagatgcgtcaaaatcgttat---------------atagattgaattgataatactttacatttgatattgagtcatt |
85 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7415258 |
acttcaagtttgtagtatagagagatgcgtcaaaatcgttatgaattaaattatgttatagattgaattgataatactttacatttgatattgagtcatt |
7415357 |
T |
 |
| Q |
86 |
tatttctagtttctcccactaacttcccttgcctgtcattgaatatagagcttatggtatttattcatttatataaacaagtatgagggattgcttttgg |
185 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
7415358 |
tattcctaatttctcccactaacttcccttgcctgtcattgaatatagagcttatggtatttattcatttatataaacaagtatgagggattggttttgg |
7415457 |
T |
 |
| Q |
186 |
taaacacaaagtatcatgaaatttggttagatacgtacctctcatccaatcatttaaggtcatat |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||| |
|
|
| T |
7415458 |
taaacacaaagtatcatgaaatttggttagatatgtacctctcatccaatcattcaaggtcatat |
7415522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 250
Target Start/End: Original strand, 7461341 - 7461605
Alignment:
| Q |
1 |
acttcaagtttgtagtctagagagatgcgtcaaaatcgttat---------------atagattgaattgataatactttacatttgatattgagtcatt |
85 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7461341 |
acttcaagtttgtagtatagagagatgcgtcaaaatcgttatgaattaaattatgttatagattgaattgataatactttacatttgatattgagtcatt |
7461440 |
T |
 |
| Q |
86 |
tatttctagtttctcccactaacttcccttgcctgtcattgaatatagagcttatggtatttattcatttatataaacaagtatgagggattgcttttgg |
185 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
7461441 |
tattcctaatttctcccactaacttcccttgcctgtcattgaatatagagcttatggtatttattcatttatataaacaagtatgagggattggttttgg |
7461540 |
T |
 |
| Q |
186 |
taaacacaaagtatcatgaaatttggttagatacgtacctctcatccaatcatttaaggtcatat |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||| |
|
|
| T |
7461541 |
taaacacaaagtatcatgaaatttggttagatatgtacctctcatccaatcattcaaggtcatat |
7461605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University