View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11974_high_11 (Length: 258)
Name: NF11974_high_11
Description: NF11974
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11974_high_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 172; Significance: 2e-92; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 17 - 192
Target Start/End: Complemental strand, 30902599 - 30902424
Alignment:
| Q |
17 |
gatacatgttccttttgtagatttgattgtggttttgttggtggtttacgtgagaatgggaagattttattggctttggatggtggtgttctcccagttg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30902599 |
gatacatgttccttttgtagatttgattgtggttttgttggtggtttacgtgagaatgggaagattttattggctttggatggtggtgttctcccagttg |
30902500 |
T |
|
| Q |
117 |
tgtttgtgagagcataatgtgttcatattggatgtagatcttgcttgtgtttgtagtactatttaagtttgtgttt |
192 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30902499 |
tgtttgtgagagcataatgtgtttatattggatgtagatcttgcttgtgtttgtagtactatttaagtttgtgttt |
30902424 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 208 - 240
Target Start/End: Complemental strand, 30900978 - 30900946
Alignment:
| Q |
208 |
aaaattacaaattggtgtaatgatggtcagatt |
240 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |
|
|
| T |
30900978 |
aaaattacaaattggtgtaatgatggtcggatt |
30900946 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University