View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11974_low_12 (Length: 253)
Name: NF11974_low_12
Description: NF11974
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11974_low_12 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 34 - 253
Target Start/End: Original strand, 11592358 - 11592578
Alignment:
| Q |
34 |
cgccgagtattttggttgcctgaggtgtccctcagatacaaggtagagactaattgtccgaggtacggagattcacccaagagaacacatcttttaacag |
133 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11592358 |
cgccgagtattttggttgcatgaggtgtccctcagatacaaggtagagactaattgtccgaggtacggagattcacccaagagaacacatcttttaacag |
11592457 |
T |
|
| Q |
134 |
gggttcttccttagacacttgctaacgatcgaatctttgaccatatgctcaa-ggcacaattttccatcaaccatgccacaatatgatgatccattacat |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
11592458 |
gggttcttccttagacacttgctaacgatcgaatctttgaccatatgcttaagggcacaattttctatcaaccatgccacaatatgatgatccattacat |
11592557 |
T |
|
| Q |
233 |
caagtttggttcaacttttat |
253 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
11592558 |
caagtttggttcaacttttat |
11592578 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University