View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11975_high_24 (Length: 301)
Name: NF11975_high_24
Description: NF11975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11975_high_24 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 112; Significance: 1e-56; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 137 - 260
Target Start/End: Complemental strand, 24573159 - 24573036
Alignment:
| Q |
137 |
gaatggtttaccattcaatggatcaatagcatgccacgagaaaatagtttgattgagattctcttggaatactttgtactgattgagatgttgcatgttt |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
24573159 |
gaatggtttaccattcaatggatcaatagcatgccaccagaaaatagtttgattgagattctcttggaatactttgtaccgattgagatgttacatgttt |
24573060 |
T |
|
| Q |
237 |
tattttgaccgataaatttcatca |
260 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
24573059 |
tattttgaccgataaatttcatca |
24573036 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 22 - 89
Target Start/End: Complemental strand, 24573270 - 24573203
Alignment:
| Q |
22 |
agcatattctttgactacgcttttgatttttaaaacataaagagaacttctaaagatatgaatgcatt |
89 |
Q |
| |
|
|||||||||||||| ||||||||||| |||| ||| |||||||||||||||||||||||||||||||| |
|
|
| T |
24573270 |
agcatattctttgattacgcttttgagtttttaaatataaagagaacttctaaagatatgaatgcatt |
24573203 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University