View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11975_low_31 (Length: 253)
Name: NF11975_low_31
Description: NF11975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11975_low_31 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 222; Significance: 1e-122; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 12 - 253
Target Start/End: Complemental strand, 3126090 - 3125849
Alignment:
| Q |
12 |
agagagggagagatggcagggaggcattgttacaaagatgtgctcccattcacagcaatggttgcaatagagtgcacaaacgttggtgttagtgttctat |
111 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
3126090 |
agagagagagagatggcagggaggcattgttacaaggatgtgctcccattcacggcaatggttgcaatagagtgcacaaacgttggtgtcagtgttctat |
3125991 |
T |
|
| Q |
112 |
tcaaagcagctactcaaaaagggttgagttactatgtcttcattgcctattcatatgttgtctccactcttgttctccttttgcctctccccttctttat |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3125990 |
tcaaagcagctactcaaaaagggttgagttactatgtcttcattgcctattcatttgttgtctccactcttgttctccttttgcctctccccttctttat |
3125891 |
T |
|
| Q |
212 |
caaatggtgatctctttttacatagttattagtaattgaacc |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3125890 |
caaatggtgatctctttttacatagttattagtaattgaacc |
3125849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 96 - 253
Target Start/End: Original strand, 3556027 - 3556184
Alignment:
| Q |
96 |
ggtgttagtgttctattcaaagcagctactcaaaaagggttgagttactatgtcttcattgcctattcatatgttgtctccactcttgttctccttttgc |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
3556027 |
ggtgttagtgttctattcaaagcagctactcaaaaggagttgagttactatgtcttcattgcctattcatttgttgtctccactcttgttctccttttgc |
3556126 |
T |
|
| Q |
196 |
ctctccccttctttatcaaatggtgatctctttttacatagttattagtaattgaacc |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3556127 |
ctctccccttctttatcaaatggtgatctctttttacatagttattagtaattgaacc |
3556184 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University