View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11975_low_32 (Length: 253)
Name: NF11975_low_32
Description: NF11975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11975_low_32 |
 |  |
|
| [»] scaffold1861 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold1861 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: scaffold1861
Description:
Target: scaffold1861; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 11 - 70
Target Start/End: Original strand, 1230 - 1289
Alignment:
| Q |
11 |
tgagatgaaagagattgacttggggtcagggatataaattgaaaaaagtattgatatttt |
70 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
1230 |
tgagatgaaagagattgacttggggtcagggatgtaaattgaaaaaagtattgatatttt |
1289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 99 - 147
Target Start/End: Complemental strand, 41699418 - 41699370
Alignment:
| Q |
99 |
aacttataaaatcacactaaaaacaaatgttaatttggttgagagagag |
147 |
Q |
| |
|
||||||||||||||| |||||| |||| |||||||| ||| |||||||| |
|
|
| T |
41699418 |
aacttataaaatcactctaaaatcaaacgttaattttgttaagagagag |
41699370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University