View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11975_low_34 (Length: 221)
Name: NF11975_low_34
Description: NF11975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11975_low_34 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 19 - 205
Target Start/End: Complemental strand, 29879705 - 29879519
Alignment:
| Q |
19 |
agatgcagaagaaaacttagtaggaaattttttcctttgattggtatgaacagaagatgatgaatcatcaatgagagttctagagactcttgatctcttt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
29879705 |
agatgcagaagaaaacttagtaggaaattttttcctttgattggtatgaacagaagatgatgaatcttcaatgagagttcgagagactcttgatctcttt |
29879606 |
T |
 |
| Q |
119 |
ctttgaccccatttcaacagcacatcaccaccaccaccacttggacttgtgctgttgttgctgttgctatgacttgtctgaggagag |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29879605 |
ctttgaccccatttcaacagcacatcaccaccaccaccacttggacttgtgctgttgttgctgttgctatgacttgtctgaggagag |
29879519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University