View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11976_low_19 (Length: 296)
Name: NF11976_low_19
Description: NF11976
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11976_low_19 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 166; Significance: 7e-89; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 166; E-Value: 7e-89
Query Start/End: Original strand, 124 - 293
Target Start/End: Original strand, 28397671 - 28397840
Alignment:
| Q |
124 |
atgagtatgatttccgatcatggctcaagattcaactctcctttttcttgttttgatcataaatggcttgaatgtacctttgcattgttggtctcaactc |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28397671 |
atgagtatgatttccgatcatggctcaagattcaactctcctttttcttgttttgatcataaatggcttgaatgtacctttgcattgttggtctcaactc |
28397770 |
T |
 |
| Q |
224 |
cactgcgttatttatttatgttgctgtttgtttttagagtaaagttcctagctttctagcgcactttcaa |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
28397771 |
cactgcgttatttatttatgttgctgtttgtttttagagtaaagttcctagctttatagcgcactttcaa |
28397840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University