View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11976_low_23 (Length: 251)
Name: NF11976_low_23
Description: NF11976
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11976_low_23 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 171; Significance: 6e-92; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 1 - 175
Target Start/End: Complemental strand, 45514551 - 45514377
Alignment:
| Q |
1 |
tttgcagtgtccagttgcttgaaaatttaaaaaattcccctttttgtagaagagcccgtaaccaacattcataaacctttttgaatattgaaaggtttaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45514551 |
tttgcagtgtccagttgcttgaaaatttaaaaaattcccctttttgtagaagagcccgtaaccaacattcataaacctttttgaatattgaaaggtttaa |
45514452 |
T |
|
| Q |
101 |
agggctgagaaaaatggtaaatatttggaatcattagattaaggggagatgttctgagatgatccatccagttac |
175 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45514451 |
agggttgagaaaaatggtaaatatttggaatcattagattaaggggagatgttctgagatgatccatccagttac |
45514377 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 196 - 238
Target Start/End: Complemental strand, 45514360 - 45514318
Alignment:
| Q |
196 |
ccaagtaacttatcgactacttatgatataagtgggggtgtct |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45514360 |
ccaagtaacttatcgactacttatgatataagtgggggtgtct |
45514318 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University