View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11976_low_25 (Length: 245)
Name: NF11976_low_25
Description: NF11976
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11976_low_25 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 17 - 227
Target Start/End: Complemental strand, 19427631 - 19427427
Alignment:
| Q |
17 |
ccgatacaaaccagttttcccctcctccactaccgtgacattttccagtttccggtttccagttttatcactttctacacaaataacttttgctcccgcc |
116 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
19427631 |
ccgatacaaaccagttttcctctcctccactaccgtgacattttcc-------ggtttccagttttatcactttctgcacaaacaacttttgctcccgcc |
19427539 |
T |
|
| Q |
117 |
acccatttcagtgaccactatggcaattgaccacacaatttgagttgcaatcccctatctgatcag-ccccgaaagtgttgtcccatatcctctttcaca |
215 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
19427538 |
acccatttcagtgaccactatggcaactgaccacacaatttgacttgcaatcccctatctgatcagcccccgaaagtgttgtcccatatcctctttcaca |
19427439 |
T |
|
| Q |
216 |
tacccacatgtg |
227 |
Q |
| |
|
||||||||||| |
|
|
| T |
19427438 |
gacccacatgtg |
19427427 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University