View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11976_low_26 (Length: 242)
Name: NF11976_low_26
Description: NF11976
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11976_low_26 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 234; Significance: 1e-129; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 45938431 - 45938672
Alignment:
| Q |
1 |
ttttgataaggaaggttatagacacactgcagctgatttgttagagtatgctgatccaaagaaaatttcggtttatttgcatgcgacagttcaaaagata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45938431 |
ttttgataaggaaggttatagacacactgcagctgatttgttagagtatgctgatccaaagaaaatttcggtttatttgcatgcgacagttcaaaagata |
45938530 |
T |
 |
| Q |
101 |
ctattcaagtataataaaagtatgtatttaagaatgcctcatattaactttttatatctgccctaaattgtctttataaaatatacttgtaagatgatga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45938531 |
ctattcaagtataataaaagtatgtatttaagaatgcctcatattaactttttatatctaccctaaattgtctttataaaatatacttgtaagatgatga |
45938630 |
T |
 |
| Q |
201 |
agtcttaactctctttattcaatgtgttattagagtttttct |
242 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
45938631 |
agtcttaactctctttattcaatgtgttactagagtttttct |
45938672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 5 - 110
Target Start/End: Original strand, 45945199 - 45945304
Alignment:
| Q |
5 |
gataaggaaggttatagacacactgcagctgatttgttagagtatgctgatccaaagaaaatttcggtttatttgcatgcgacagttcaaaagatactat |
104 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||||||||||||||||| |||||||||| |||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
45945199 |
gataaggaaggtcataaacacactgcagctgatttgttagagtatgccgatccaaagagaatttctgtttatttgcatgccacagttcaaaagatactat |
45945298 |
T |
 |
| Q |
105 |
tcaagt |
110 |
Q |
| |
|
|||||| |
|
|
| T |
45945299 |
tcaagt |
45945304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University