View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11977_high_31 (Length: 336)
Name: NF11977_high_31
Description: NF11977
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11977_high_31 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 311; Significance: 1e-175; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 311; E-Value: 1e-175
Query Start/End: Original strand, 18 - 336
Target Start/End: Complemental strand, 972022 - 971704
Alignment:
| Q |
18 |
gatgggagatgttggagtgacatcaatcatattaacagtatttttatagattatttcactaatatttttgctacttcaaaccccactaacatgcaggata |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
972022 |
gatgggagatgttggagtgacatcaatcatattaacagtatttttatagattatttcactaatatttttgctacttcaaaccccactaacatgcaggata |
971923 |
T |
 |
| Q |
118 |
ctattgaagttgttaaaaatataatcaagcctgatatgcatgagtacctctagcaagatttcactgctaccgaggtttttgaggctattagacagatgaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
971922 |
ctattgaagttgttaaaaatataatcaagcctgatatgcatgagtacctctagcaagatttcactgctactgaggtttttgaggctattagacagatgaa |
971823 |
T |
 |
| Q |
218 |
aagttcagctgcccctggaccagatggtttacctgccctgttctatcaatcctattgggcagaaattggtactgagattattgagtatgcccttaatatt |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
971822 |
aagttcagctgcccctggaccagatggtttacctgccctgttctatcaatcctattgggcagaaattggtactgagattattgagtatgcccttaatgtt |
971723 |
T |
 |
| Q |
318 |
cttaataacaatggagatc |
336 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
971722 |
cttaataacaatggagatc |
971704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University