View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11977_high_39 (Length: 317)
Name: NF11977_high_39
Description: NF11977
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11977_high_39 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 295; Significance: 1e-166; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 295; E-Value: 1e-166
Query Start/End: Original strand, 1 - 303
Target Start/End: Original strand, 42445675 - 42445977
Alignment:
| Q |
1 |
tggtttcagtctctcagctgatgtacatgtcctaccagcaacacatgtaagctatgctgctggactaaagatcaaggcctacataaattccacttcaccg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42445675 |
tggtttcagtctctcagctgatgtacatgtcctaccagcaacacatgtaagctatgctgctggactaaagatcaaggcctacataaattccacttcaccg |
42445774 |
T |
 |
| Q |
101 |
acagcaaccatttcgtttaagggaacgattatcgggaactccttagcgccatccgttgcatcattctcttcaagaggtcccaacttgccgagtcctggta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42445775 |
acagcaaccatttcgtttaagggaacgattatcgggaactccttagcgccatccgttgcatcattctcttcaagaggtcccaacttgccgagtcctggta |
42445874 |
T |
 |
| Q |
201 |
tattgaaaccggatattataggaccaggcgtgaacatcctagcggcatggccattccccctggataacaacaccaattcaaaactaaatttcaacatgat |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
42445875 |
tattgaaaccggatattataggaccaggcgtgaacatcctggcggcatggccattccccctggataacaacaccaattcaaaactaaatttcaacattat |
42445974 |
T |
 |
| Q |
301 |
gtc |
303 |
Q |
| |
|
||| |
|
|
| T |
42445975 |
gtc |
42445977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University