View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11977_high_58 (Length: 244)
Name: NF11977_high_58
Description: NF11977
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11977_high_58 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 53472818 - 53473042
Alignment:
| Q |
1 |
tttgaactgaacaatagtgtacacggacagtgactgttgtcatgtactttaaaaacgtgaatgtgggttgatatggtcggccataatttcaagagtttat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53472818 |
tttgaactgaacaatagtgtacacggacagtgactgttgtcatgtactttaaaaacgtgaatgtgggttgatatggtcggccataatttcaagagtttat |
53472917 |
T |
|
| Q |
101 |
agagttcaacaagggtggtatgttaggttcctctttaaggttgtaatccatcagttcatgcccctaagtagcacatagtaatccatcatcactatctggt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
53472918 |
agagttcaacaagggtggtatgttaggttcctctttaaggttgtaatccatcagttcatgcccctaagtagcacatagtaatccatcattactatctggt |
53473017 |
T |
|
| Q |
201 |
aatctattttgtggtccataaagat |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
53473018 |
aatctattttgtggtccataaagat |
53473042 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University