View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11977_high_61 (Length: 241)
Name: NF11977_high_61
Description: NF11977
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11977_high_61 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 19 - 241
Target Start/End: Original strand, 6966685 - 6966917
Alignment:
| Q |
19 |
tttgcagctttggggcctcatacatacttgcttgttacgttaaaataaaatggatacatcat---------------ggtcaatggaccacacattcatg |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
6966685 |
tttgcagctttggggcctcatacatacttgcttgttacgttaaaat-----ggatacatcatagcaaaatgacacgtggtcattggaccacacattcatg |
6966779 |
T |
 |
| Q |
104 |
gctataatattagagattagacatctctccatgcatgctatgttcatataactgatttgaaagtggcaaaatatgaaatttccatgtgcttgcccaagta |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
6966780 |
gctataatattagagattagacatctctccatgcatgctatgttcatataactgatttgaaagtggcaaaatatgaaatttccatgtgcttgctcaagta |
6966879 |
T |
 |
| Q |
204 |
cttattaactcttgttattgacaggttgtaactgttgc |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6966880 |
cttattaactcttgttattgacaggttgtaactgttgc |
6966917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University