View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11977_high_68 (Length: 229)
Name: NF11977_high_68
Description: NF11977
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11977_high_68 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 72; Significance: 7e-33; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 154 - 229
Target Start/End: Complemental strand, 44910369 - 44910294
Alignment:
| Q |
154 |
cataccaatatgtaaatagaagcttatgatttgtatatgtcataccataatataatataatattgtagtttgaaat |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
44910369 |
cataccaatatgtaaatagaagcttatgatttgtatatgccataccataatataatataatattgtagtttgaaat |
44910294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 3 - 60
Target Start/End: Complemental strand, 44910433 - 44910376
Alignment:
| Q |
3 |
attgttcaatgaggatatagagactactgtaagcatatttatggcttttatgtactac |
60 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
44910433 |
attgttcaatgaggatatagagactactgtaagcatatttatggcttttatttactac |
44910376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University