View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11977_high_73 (Length: 215)

Name: NF11977_high_73
Description: NF11977
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11977_high_73
NF11977_high_73
[»] chr6 (1 HSPs)
chr6 (18-198)||(27233580-27233762)


Alignment Details
Target: chr6 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 18 - 198
Target Start/End: Complemental strand, 27233762 - 27233580
Alignment:
18 ctaccatggctcatttttactttatatcggttttacccttatggctcaatggacgggctactgtggcatcacgtagagg-gatcagatgtgctctgagcc 116  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||    
27233762 ctaccatggctcatttttactttatatcggttttacccttatggctcaatggacaggctactgtggcatcacgtagaggagatcagatgtgctctgagcc 27233663  T
117 tgatattttgtgcatcttgactctctac-cggttcatgtagccttaagtcgtagatgaacgccttattaaaccttagatgtct 198  Q
    |||||||||| |||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||||||||    
27233662 tgatattttgcgcatcttgactctctacgaggttcatgtagccttaagtcgtagatgaacgccttattaaaccttagatgtct 27233580  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University