View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11977_low_24 (Length: 403)
Name: NF11977_low_24
Description: NF11977
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11977_low_24 |
 |  |
|
| [»] scaffold0197 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0197 (Bit Score: 361; Significance: 0; HSPs: 1)
Name: scaffold0197
Description:
Target: scaffold0197; HSP #1
Raw Score: 361; E-Value: 0
Query Start/End: Original strand, 19 - 391
Target Start/End: Original strand, 3054 - 3426
Alignment:
| Q |
19 |
gattaagccaccatttccttggataacatttaactttgaaattgacacacaacccatgtatagagactacattgtcttccctattggcaataaggaacaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3054 |
gattaagccaccatttccttggataaaatttaactttgaaattgacacacaaccaatgtatagagactacattgtcttccctattggcaataaggaacaa |
3153 |
T |
 |
| Q |
119 |
taatctaagaaaaaccattatatagatccatatctaagagcaaatcctcccaattccattggctactactaccctctcctccacttaccatagcttcaaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3154 |
taatctaagaaaaaccattatatagatccatatctaagagcaaatcctcccaattccattggctactactaccctctcctccacttaccatagcttcaaa |
3253 |
T |
 |
| Q |
219 |
tccttctaattgaaaatccattggaaactcaccaaccataccttgttggtccaagcatgaaaacaccatcatgtcttgttgtgattcaagcatatgattc |
318 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3254 |
tccttctaattgaaaatccattggaaactcaccaaccataccttgttggtccaagcatgaatacaccatcatgtcttgttgtgattcaagcatatgattc |
3353 |
T |
 |
| Q |
319 |
tttccatcagcatcaaatgttgtcatgtcactctcttgttgaactagaacttggtcagttggtgactctcctt |
391 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3354 |
tttccatcagcatcaaatgttgtcatgtcactctcttgttgaactagaacttggtcagttggtgactctcctt |
3426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University