View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11977_low_40 (Length: 304)
Name: NF11977_low_40
Description: NF11977
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11977_low_40 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 102; Significance: 1e-50; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 61 - 193
Target Start/End: Complemental strand, 23809551 - 23809418
Alignment:
| Q |
61 |
attgagatacacgtgttaaactataattcacttaatgaatacaagtttatagagatttttcctgtgatttcgaagtaacggatgcaagtactgttgtgta |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
23809551 |
attgagatacacgtgttaaactataattcacttaatgaatgcaagtttgtagagatttttcctgtgatttcgaagtaacggatgcaagtagtgttgtgta |
23809452 |
T |
 |
| Q |
161 |
aaaatatggttagttgaa-aatatgtgaataagc |
193 |
Q |
| |
|
|||||||||||| |||| |||||||||||||| |
|
|
| T |
23809451 |
aaaatatggttaactgaaccatatgtgaataagc |
23809418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 193 - 246
Target Start/End: Complemental strand, 23809387 - 23809336
Alignment:
| Q |
193 |
catattaaatggttcatgaactaaatcataaattttgaaaagatcaattaacca |
246 |
Q |
| |
|
||||||||||||||| |||||||| || ||||||||||||||||||||||||| |
|
|
| T |
23809387 |
catattaaatggttc--gaactaaaccacaaattttgaaaagatcaattaacca |
23809336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University