View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11977_low_54 (Length: 256)

Name: NF11977_low_54
Description: NF11977
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11977_low_54
NF11977_low_54
[»] chr3 (1 HSPs)
chr3 (1-138)||(39272826-39272963)


Alignment Details
Target: chr3 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 1 - 138
Target Start/End: Original strand, 39272826 - 39272963
Alignment:
1 acttcatggacttggtaattgtaggagttggaaggacaccaaccgcgatatatgatgttttgtttttccatttcctatatatatggaattgaaagtgccc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39272826 acttcatggacttggtaattgtaggagttggaaggacaccaaccgcgatatatgatgttttgtttttccatttcctatatatatggaattgaaagtgccc 39272925  T
101 agttctgtttgtgaatggtgttgaaattgtgttcctac 138  Q
    ||||||||||||||||||||||||||||||||||||||    
39272926 agttctgtttgtgaatggtgttgaaattgtgttcctac 39272963  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University