View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11977_low_55 (Length: 253)
Name: NF11977_low_55
Description: NF11977
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11977_low_55 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 68; Significance: 2e-30; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 71 - 138
Target Start/End: Original strand, 36300453 - 36300520
Alignment:
| Q |
71 |
tgcctggctttcccatgtacgcctgtagtgatgaattctccaacacaaatgagatcaatcctagtctt |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36300453 |
tgcctggctttcccatgtacgcctgtagtgatgaattctccaacacaaatgagatcaatcctagtctt |
36300520 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 71 - 136
Target Start/End: Original strand, 36289004 - 36289069
Alignment:
| Q |
71 |
tgcctggctttcccatgtacgcctgtagtgatgaattctccaacacaaatgagatcaatcctagtc |
136 |
Q |
| |
|
|||||||||||||| ||||| || ||||||||||| |||| ||||||||||||| ||||||||| |
|
|
| T |
36289004 |
tgcctggctttcccgtgtacaccgcaagtgatgaattttccaccacaaatgagatcgatcctagtc |
36289069 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University