View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11977_low_71 (Length: 217)
Name: NF11977_low_71
Description: NF11977
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11977_low_71 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 210
Target Start/End: Original strand, 50843367 - 50843576
Alignment:
| Q |
1 |
gccactgcacccagttatcctttggcttctcccatccatcagattagagctattcttgcttattgatgagtctaaaaatatttaggttagagccttctaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50843367 |
gccactgcacccagttatcctttggcttctcccatccatcagattagagctattcttgcttattgatgagtctaaaaatatttaggttagagccttctaa |
50843466 |
T |
|
| Q |
101 |
ggtctcataggtctagtaaaagaagcatcatgcagcttcttatttctggatttccaaagagcagcttcccaaatggcatcctaacctcgagggaatgaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
50843467 |
ggtctcataggtctagtaaaagaagcatcatgcagcttcttatttctggatttccaaagagcagctgcccaaatggcatcctaacctcgagggaatgaaa |
50843566 |
T |
|
| Q |
201 |
ttatcctttg |
210 |
Q |
| |
|
|||||||||| |
|
|
| T |
50843567 |
ttatcctttg |
50843576 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University