View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11977_low_73 (Length: 216)
Name: NF11977_low_73
Description: NF11977
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11977_low_73 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 14 - 216
Target Start/End: Original strand, 15574747 - 15574949
Alignment:
| Q |
14 |
aaggcttatcatcattggagaaagtaaacatgcaagtatcttgttgggaaggagaaacatgagaaggaagagaataccaactagagttagtatcatgaac |
113 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15574747 |
aaggcttatcatcgttggagaaagtaaacatgcaagtatcttgttgggaaggagaaacatgagaaggaagagaataccaactagagttagtatcatgaac |
15574846 |
T |
 |
| Q |
114 |
attttttgacttgaaactaatttgagattcttcactcaaagagaattcagaattataagaagaagggtcataaaaccaatgagtatgatcagaaccatgg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15574847 |
attttttgacttgaaactaatttgagattcttcactcaaagagaattcagaattataagaagaagggtcataaaaccaatgagtatgatcagaaccatgg |
15574946 |
T |
 |
| Q |
214 |
taa |
216 |
Q |
| |
|
||| |
|
|
| T |
15574947 |
taa |
15574949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University