View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11977_low_74 (Length: 215)
Name: NF11977_low_74
Description: NF11977
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11977_low_74 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 18 - 198
Target Start/End: Complemental strand, 27233762 - 27233580
Alignment:
| Q |
18 |
ctaccatggctcatttttactttatatcggttttacccttatggctcaatggacgggctactgtggcatcacgtagagg-gatcagatgtgctctgagcc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
27233762 |
ctaccatggctcatttttactttatatcggttttacccttatggctcaatggacaggctactgtggcatcacgtagaggagatcagatgtgctctgagcc |
27233663 |
T |
|
| Q |
117 |
tgatattttgtgcatcttgactctctac-cggttcatgtagccttaagtcgtagatgaacgccttattaaaccttagatgtct |
198 |
Q |
| |
|
|||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27233662 |
tgatattttgcgcatcttgactctctacgaggttcatgtagccttaagtcgtagatgaacgccttattaaaccttagatgtct |
27233580 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University