View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11979_low_11 (Length: 305)
Name: NF11979_low_11
Description: NF11979
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11979_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 116; Significance: 5e-59; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 116; E-Value: 5e-59
Query Start/End: Original strand, 18 - 137
Target Start/End: Original strand, 39824875 - 39824994
Alignment:
| Q |
18 |
gttgtttggtgcaaataaggtagtgaatgtgtgaattgcgtcatagagagattgagaaactagagaagaaattaacaacctagatggtggaaacttgaaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39824875 |
gttgtttggtgcaaataaggtagtgaatgtgtgaattgcgtcatagagagattgagaaactacagaagaaattaacaacctagatggtggaaacttgaaa |
39824974 |
T |
 |
| Q |
118 |
agagatttgattaatgagag |
137 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
39824975 |
agagatttgattaatgagag |
39824994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 116; E-Value: 5e-59
Query Start/End: Original strand, 166 - 301
Target Start/End: Original strand, 39825021 - 39825156
Alignment:
| Q |
166 |
gttgataccctggttttaaattgtggttgcagttatgctataaccttgaggtcgacggagtgaacctttatattacaacgaaatgagaccgatgcagtga |
265 |
Q |
| |
|
||||||||||||||||||||||| ||||| || |||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39825021 |
gttgataccctggttttaaattgcggttgtagatatgctatgaccttgaggccgacggagtgaacctttatattacaacgaaatgagaccgatgcagtga |
39825120 |
T |
 |
| Q |
266 |
aaattgcgggtgagattactttgcagagacgtcaaa |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
39825121 |
aaattgcgggtgagattactttgcagagacgtcaaa |
39825156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University