View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11979_low_13 (Length: 270)
Name: NF11979_low_13
Description: NF11979
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11979_low_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 1 - 252
Target Start/End: Complemental strand, 47803214 - 47802963
Alignment:
| Q |
1 |
ttatcacacctaccccctcagaatcatggtccaactttagttctataatctttactatctctaagcagtcacagcacagtccttgaacacctctaactag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47803214 |
ttatcacacctaccccctcagaatcatggtccaactttagttctataatctttactatctctaagcagtcacagcacagtccttgaacacctctaactag |
47803115 |
T |
 |
| Q |
101 |
agtaaattctgaagtagaaacacactttttgcatacagcatttggacaaccaaggcaacataacttggagcgtttactgcagttgtagcaacaatgccta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47803114 |
agtaaattctgaagtagaaacacactttttgcatacagcatttggacaaccaaggcaacaaaacttggagcgtttactgcagttgtagcaacaatgccta |
47803015 |
T |
 |
| Q |
201 |
cctgaaaatacaaatgcatgcaaaacattacttttgatctctaccggttaac |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
47803014 |
cctgaaaatacaaatgcatgcaaaacattacttttgatctctaccagttaac |
47802963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University