View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11979_low_14 (Length: 253)
Name: NF11979_low_14
Description: NF11979
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11979_low_14 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 86 - 244
Target Start/End: Original strand, 47803380 - 47803539
Alignment:
| Q |
86 |
aagcgaatgtttgtaacgtggtggttatgttagtttcacctccnnnnnnnnnn-aaaactcattttacgtcacttagctcaccgcccgagctacctacat |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47803380 |
aagcgaatgtttgtaacgtggtggttatgttagtttcacctcctttttttttttaaaactcattttacgtcacttagctcaccgcccgagctacctacat |
47803479 |
T |
|
| Q |
185 |
aggacactagtatttacatattgattttgaaacatgtacttttcagtaatttcatctcat |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47803480 |
aggacactagtatttacatattgattttgaaacatgtacttttcagtaatttcatctcat |
47803539 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 204 - 241
Target Start/End: Original strand, 47806322 - 47806359
Alignment:
| Q |
204 |
attgattttgaaacatgtacttttcagtaatttcatct |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
47806322 |
attgattttgaaacatgtacttttcagtaattttatct |
47806359 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University