View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11979_low_18 (Length: 231)
Name: NF11979_low_18
Description: NF11979
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11979_low_18 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 208
Target Start/End: Complemental strand, 35965598 - 35965391
Alignment:
| Q |
1 |
aaagtgaaaccaaacatacatttactattccagctggactcaaccacccaactgaaagtgtgtgtttattttcagctaacctaaatgtttgtgtttttct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35965598 |
aaagtgaaaccaaacatacatttactattccagctggactcaaccacccaactgaaagtgtgtgtttattttcagctaacctaaatgtttgtgtttttct |
35965499 |
T |
 |
| Q |
101 |
gacacataatctagacatctacgtgaattgtttagttccatagactcataaacagtccaagttgttaaatatttggtcctctcccctattaaccgcgaat |
200 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35965498 |
gacacataatctagacatctacgtaaattgtttagttccatagactcataaacagtccaagttgttaaatatttggtcctctcccctattaaccgcgaat |
35965399 |
T |
 |
| Q |
201 |
attcacca |
208 |
Q |
| |
|
|||||||| |
|
|
| T |
35965398 |
attcacca |
35965391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University