View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11980_high_103 (Length: 238)
Name: NF11980_high_103
Description: NF11980
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11980_high_103 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 46085732 - 46085509
Alignment:
| Q |
1 |
tgcagatggcatgcgtttaaaagaaggtatttctctttattaatgatacaacataactataaggttaagaatagaattgttaaaatataaattttgaaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46085732 |
tgcagatggcatgcgtttaaaagaaggtatttctctttattaatgatacaacataaatataaggttaagaatagaattgttaaaatataaattttgaaag |
46085633 |
T |
 |
| Q |
101 |
tttaatcgattaataattccctttttgttgctagact----gctatgttctttttgggtgataagttctctgttatttaataatcaattattcatggatt |
196 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46085632 |
tttaatc-attaataattccctttttggtgctagactgctagctatgttctttttaggtgataagttctctgttatttaataatcaattattcatggatt |
46085534 |
T |
 |
| Q |
197 |
aggaattcatatcaacaagggttta |
221 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
46085533 |
aggaattcatatcaacaagggttta |
46085509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University