View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11980_high_65 (Length: 293)
Name: NF11980_high_65
Description: NF11980
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11980_high_65 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 7 - 280
Target Start/End: Complemental strand, 29907602 - 29907321
Alignment:
| Q |
7 |
aggtttgacctccaatttaatacccacccctgatttgaacgacgacaacgttgtttgctacttccagtcatcatgccaagaggagtttggtgaaggattt |
106 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29907602 |
aggtttgacctccaatttaatactcacccctgatttgaacgacgacaatgttgtttgctacttccagtcatcatgccaagaggagtttggtgaaggattt |
29907503 |
T |
 |
| Q |
107 |
gatgaggtttctcggaagaggtcaaagaaatcagccaagtctgctaaggttgtcaaggattgaaatgtgatgtattttgctttatatcctcatgcggtct |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29907502 |
gatgaggtttctcggaagaggtcaaagaaatcagccaagtctgctaaggttgtcaaggattgaaatgtgatgtattttgctttatatcctcatgcggtct |
29907403 |
T |
 |
| Q |
207 |
cacgagaaatgtgatgtatttacgtatgt--------aactttctaatctattgtttccatgctatagtttatttgtgttct |
280 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29907402 |
cacgagaaatgtgatgtgtttacgtatgttgctgctgaactttctaatctattgtttccatgctatagtttatttgtgttct |
29907321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University