View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11980_high_72 (Length: 272)
Name: NF11980_high_72
Description: NF11980
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11980_high_72 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 71 - 261
Target Start/End: Original strand, 32861069 - 32861259
Alignment:
| Q |
71 |
tgggttttggagtaattttagaaatgttttgttggggaattttatgatgggttctaagttggatgatgagtatagacaagctgttgttagggttgatgaa |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32861069 |
tgggttttggagtaattttagaaatgttttgttgggaaattttatgatgggttctaagttggatgatgagtatagacaagctgttgttagggttgatgaa |
32861168 |
T |
 |
| Q |
171 |
gttctatctaaggtgagttcttgtttttgatgttttatcattttttaatctgtttggataattaattgtttcatatagcataagcacttat |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32861169 |
gttctatctaaggtgagttcttgtttttgatgttttatcattttttaatctgtttggataattaattgtttcatatagcataagcacttat |
32861259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University