View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11980_high_81 (Length: 253)

Name: NF11980_high_81
Description: NF11980
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11980_high_81
NF11980_high_81
[»] chr8 (2 HSPs)
chr8 (1-229)||(26556397-26556625)
chr8 (7-185)||(26776056-26776234)


Alignment Details
Target: chr8 (Bit Score: 217; Significance: 1e-119; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 26556625 - 26556397
Alignment:
1 aaagcatttgaaaatacattggcgaattatccggaggacgctgtggatcgatgggtgaaaattgcggctgatgtgcccgggaaaactttagaagagatta 100  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
26556625 aaagcatttgaaaatacattggcgaattatcccgaggacgctgtggatcgatgggagaaaattgcggctgatgtgcccgggaaaactttagaagagatta 26556526  T
101 aacgtcgctatgtggttttgtttgatgatatcaaccacattgaatctggttttgtgcctctgccagattatgattctttttcaaagagctcaacaacgtg 200  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26556525 aacgtcactatgtggttttgtttgatgatatcaaccacattgaatctggttttgtgcctctgccagattatgattctttttcaaagagctcaacaacgtg 26556426  T
201 tgctggtgaaggaggagctgtgaaaaagg 229  Q
    |||||||||||||||||||||||||||||    
26556425 tgctggtgaaggaggagctgtgaaaaagg 26556397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 7 - 185
Target Start/End: Original strand, 26776056 - 26776234
Alignment:
7 tttgaaaatacattggcgaattatccggaggacgctgtggatcgatgggtgaaaattgcggctgatgtgcccgggaaaactttagaagagattaaacgtc 106  Q
    |||||| || ||||||| |||||||| || || | |||||||||||||| ||| |||||||| | |||||| ||||||||||| ||| | ||||||| ||    
26776056 tttgaatatgcattggccaattatcctgacgatgttgtggatcgatgggagaagattgcggccggtgtgcctgggaaaactttggaacaaattaaacatc 26776155  T
107 gctatgtggttttgtttgatgatatcaaccacattgaatctggttttgtgcctctgccagattatgattctttttcaaa 185  Q
     ||||| ||||||| | ||||||||  || ||||||||||||||||||||||||| |||||||||||||||||||||||    
26776156 actatgaggttttggtagatgatattcacaacattgaatctggttttgtgcctctaccagattatgattctttttcaaa 26776234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University