View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11980_high_94 (Length: 242)
Name: NF11980_high_94
Description: NF11980
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11980_high_94 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 10 - 242
Target Start/End: Complemental strand, 52827054 - 52826822
Alignment:
| Q |
10 |
gacatcaatgaaaggtctacaaagcttgattaagaagtcaacgccgtcatcttttgtgtacatatccgagaaacttggaaattcactcattgacaaggta |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
52827054 |
gacatcaatgaaaggtctacaaagcttgattaagaagtcaacaccgtcatcttttgtgtacatatctgagaaacttggaaattcactcattgacaaggta |
52826955 |
T |
|
| Q |
110 |
cttttggaaaggaaacttatttaatttatatgtatacgttatggaaaataatgctttgatcttgtctcttttttagatggatgaattagcatgttttgtt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52826954 |
cttttggaaaggaaacttatttaatttatatgtatacgttatggaaaataatgctttgatcttgtctcttttttagatggatgaattagcatgttttgtt |
52826855 |
T |
|
| Q |
210 |
cctggaatgctggctttgggatcttctggctac |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
52826854 |
cctggaatgctggctttgggatcttctggctac |
52826822 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University